glutathione effects on eyes ✨What better way to breathe life back into weary than with our favorite @abib.global eye patches? 😍These EYEconic patches address the biggest concerns for the delicate under eye area, and deliver Glutathione Benefits for Your Skin

Check out our tips on boosting glutathione levels

M., van Wetten, M

L.SeidelA.JacobJ.DoehmerJ.MorrowC

Work from the Huberman Laboratory at Stanford School of Medicine has been published in top journals including Nature , Science and Cell and has been featured in TIME , BBC , Scientific American , Discover and other top media outlets

sgRNA constructs and gene expressing codon optimized (OPT) plasmid constructs sgRNA control and constructs against CBS and L2HGDH were designed targeting GTATTACTGATATTGGTGGG (sgControl) (#230080, Addgene), GGAGCAGACAACCTACGAGG (sg CBS -1) (#230081, Addgene), TGGCAGTGCTGGCAGCACGG (sg CBS -2) (#230082, Addgene), GATATAGTCATCGTTGGTGG (sg L2HGDH -1) (#230083, Addgene), and CACCAGACTGGACATAACAG (sg L2HGDH -2) (#230084, Addgene) and constructed in lentiCRISPR v2-Blast (#83480, Addgene) for Blasticidin selection at a final concentration of 5 g/ml

my skin felt incredibly smooth, refreshed with no irritation at all